1
0
0
News
Biozentrumsseminar, Stress response to antifungal proteins in...
www.uibk.ac.at
Veranstaltungstyp: Seminar;
MUI Scientist to watch: Martin Puhr - myPoint - Medizinische ...www.i-med.ac.at › mypoint › news
www.i-med.ac.at
· Martin Puhr, Andrea Eigentler, Florian Handle, Hubert Hackl, Christian Ploner, Isabel Heidegger, Georg Schaefer, Maximilian P. Brandt, ...
Netzwerk-Profile
Facebook: Andrea Eigentler | Facebook
Andrea Eigentler is on Facebook. Join Facebook to connect with Andrea Eigentler and others you may know. Facebook gives people the power to share and makes the world ...
Facebook: Andrea Eigentler Profile | Facebook
Profile der Personen mit dem Namen Andrea Eigentler auf Facebook anzeigen Tritt Facebook bei, um dich mit Andrea Eigentler und anderen Nutzern, die du ...
Erich Gnaiger | AceMap
acemap.openacademic.ai
http://www.sciencedirect.com/science/article/pii/B · Methods in Enzymology - Gerhard Krumschnabel, Andrea Eigentler, Mario Fasching, Erich Gnaiger Combined High Resolution Respirometry and Fluorometry Validation of Safranin For Determination of Mitochondrial Membrane Potential.
Firmen-Mitarbeiter
Dipl. Ehe-, Familien- und LebensberaterInnen - Zentrum Beratung ...zentrum-beratung.at › Zentrale Innsbruck › Team
zentrum-beratung.at
Angelika Schneider. Mag.a Anja Vergeiner. Evelin Holzmann. Judith Jetzinger, BEd. Susanne Leissing. Sibel Vurgun. Martina Haun-Holzmann. Andrea Eigentler.
Ausbildung
UNIVERSIDAD DE GRANADA CAROLINA ANNELIESE DOERRIER ...
hera.ugr.es
Carolina Doerrier, Anna Draxl, Anita Wiethüchter, Andrea Eigentler, Erich Gnaiger. (2012). Mitochondrial Respiration in Permeabilized Fibres versus Homogenate from. Mouse Myocardium. An Application Study with the PBI-Shredder. Mitochondrial. Physiology Network , Aportaciones a congresos relacionados ...
Bücher
Conceptual Background and Bioenergetic/Mitochondrial Aspects of...
books.google.fi
Volume 542 of Methods in Enzymology continues the legacy of this premier serial with quality chapters authored by leaders in the field. This new volume covers...
Molecular Mechanisms of Tobacco-induced Diseases - Xing Li Wang -...
books.google.de
Despite a wealth of epidemiological evidence of the profound ill-effects of smoking on human health, we know surprisingly little about the pathogenic...
Dokumente zum Namen
Abstract Book. Date: November 4 th (Mon.) - 5 th (Tue.), Venue:...
sciencedocbox.com
105 Luncheon Seminar The OROBOROS Oxygraph-2k for high-resolution respirometry and O2k-fluorometry: a new quality in OXPHOS analysis Verena Laner 1, Phlipp Gradl 2, Andrea Eigentler 3, Mona Fontana-Ayoub 1, Mario Fasching, Erich Gnaiger 1,3* 1 OROBOROS INSTRUMENTS, Innsbruck, 2 WGT-Elektronik, ...
(PDF) Biocenter-Broschüre Umschlag...
dokumen.tips
TTATATATTTAGGTACTTCAATGTTGAGTGGATATATGTTTACTATTGTTTTATTCTTTTGATGAATTGA CCCTGTTATCATTATATAATGACATTATCTCTTATGACAGATTTGATTCAAAGTCTATTTTTTCTGACAT...
Eigentler Abstract Bioblast - Bioblast
www.bioblast.at
Eigentler A, Draxl A, Fontana-Ayoub M, Gnaiger E (2012) The ... Andrea Eigentler 2, Anna Draxl 1, Mona Fontana-Ayoub 1, Erich Gnaiger 1,2.
The anisin1 gene encodes a defensin-like protein and supports the...
www.scienceopen.com
Authors: Andrea Eigentler, István Pócsi, Florentine Marx. Publication date ( Electronic ): 24 November Journal: Archives of Microbiology. Publisher: ...
Wissenschaftliche Veröffentlichungen
The Aspergillus giganteus antifungal protein AFP NN5353 activates ...bmcmicrobiol.biomedcentral.com › articles
bmcmicrobiol.biomedcentral.com
· Ulrike Binder, Andrea Eigentler & Florentine Marx. Department of Biotechnology, National Institute of Chemistry, Hajdrihova 19, Ljubljana, ...
Veröffentlichungen allgemein
Eigentler, Andrea [WorldCat Identities]
orlabs.oclc.org
View works by Andrea Eigentler Publications about Andrea Eigentler Publications by Andrea Eigentler off 0 Publications by Andrea ...
The Aspergillus giganteus antifungal protein AFPNN5353activates the...
link.springer.com
Background The antifungal protein AFPNN5353 is a defensin-like protein of Aspergillus giganteus. It belongs to a group of secretory proteins with low molecular...
The antifungal protein PAF interferes with PKC/MPK BioMedSearch
www.biomedsearch.com
We thank Renate Weiler-Goerz, Andrea Eigentler and Ben- jamin Nitsche for technical assistance and we are grateful to all contributors of fungal strains used in this study. This work was financially supported by the Austrian Science Foundation. FWF (P B11), the Austrian National Bank OENB (9861).
The anisin1 gene encodes a defensin-like protein and supports the ...link.springer.com › article
link.springer.com
· Andrea Eigentler & Florentine Marx. Department of Microbial Biotechnology and Cell Biology, Faculty of Science and Technology, University of ...
Artikel & Meinungen
June Metabolism and Cancer articlesmetabolist.wordpress.com ›
metabolist.wordpress.com
· Gerhard Krumschnabel, Andrea Eigentler, Mario Fasching, Erich Gnaiger – Kinetic Analysis of Local Oxygenation and Respiratory Responses of ...
Sonstiges
Andrea Eigentler - rimondowww.rimondo.com › rider-details › Andrea-Eigentler
www.rimondo.com
Andrea Eigentler. Campagnereiter-Gesellschaft Tirol; Austria. Tournament results. PRO · FEI Young Rider Competition (national)
Eigentler - Names Encyclopedia
www.namespedia.com
Andrea Eigentler (1) Anna Eigentler (1) Amanda Eigentler (1) Alfred Eigentler (1) Christine Eigentler (1) Alexander Eigentler (1) Anton Eigentler (1) Christian Eigentler …
R E P O R T. - PDF Free Download
docplayer.net
R E P O R T www.i-med.ac.at/biocenter Adele Loidl Alexander Hüttenhofer Alexandra Lusser Alexandra Pipal Andrea Casari Andrea Eigentler Andreas Ploner Andreas ...
The Aspergillus giganteus antifungal protein AFP [sub] NN
plus.cobiss.net
The Aspergillus giganteus antifungal protein AFP [sub] NN5353 activates the cell wall integrity pathway and perturbs calcium homeostasis; Elektronski vir
Antidiabetic drugs influence molecular mechanisms in PubMedpubmed.ncbi.nlm.nih.gov › ...
pubmed.ncbi.nlm.nih.gov
Andreas Pircher , Martin Zieher , Andrea Eigentler , Renate Pichler , Georg Schäfer , Josef Fritz , Martin Puhr , Eberhard Steiner , Wolfgang Horninger ...
Combined high-resolution respirometry and fluorometry. Validation of...
www.infona.pl
Andrea Eigentler. D Swarowski Research Laboratory, Department of Visceral Transplant and Thoracic Surgery, Medical.
Create a SciFeed alert for new publications With following keywords ...www.mdpi.com › scifeed_display
www.mdpi.com
Andrea Eigentler. Piotr Tymoszuk. Johanna Zwick. Arndt A. Schmitz. Andreas Pircher. Florian Kocher. Andreas Schlicker. Ralf Lesche. Georg Schäfer.
Keywords CTC AND prostate cancer - Read by QxMDread.qxmd.com › keyword
read.qxmd.com
Michael Ladurner, Manuel Wieser, Andrea Eigentler, Martin Seewald, Gabriele Dobler, Hannes Neuwirt, Mona Kafka, Isabel Heidegger, Wolfgang Horninger, ...
PBI-Shredder HRR- Set - Pressure BioSciences, Inc. - ManualZillamanualzilla.com › doc › pbi-shredder-hrr--set---pres...
manualzilla.com
... Mitochondrial Respiratory Function Anna Draxl,1 Andrea Eigentler,2 Erich Gnaiger1,2 1 OROBOROS INSTRUMENTS Corp high-resolution respirometry Schöpfstr ...
Stilltreff - Eltern Kind Zentrum Hallwww.eltern-kind-zentrum-hall.com › vberatung › stilltreff
www.eltern-kind-zentrum-hall.com
Andrea Eigentler Anastasia Blioumi- Kosten: Euro 5,00. Im Januar findet der Stilltreff am 13.
Talk:Permeabilized muscle fibers - Bioblast
www.mitoglobal.org
... but significantly less compared to conventional imt preparations (preliminary observations, Andrea Eigentler showed some confocal images ...
The Aspergillus giganteus antifungal protein AFPNN5353 activates the...
cyberleninka.org
Ulrike Binder ,, Mojca Bencina ,, Andrea Eigentler, Vera Meyer and Florentine Marx. Abstract. Background: The antifungal protein AFPNN5353 is a ...
Florentine Marx
www.infona.pl
Andrea Eigentler, István Pócsi, Florentine Marx · Archives of Microbiology > > 194 > 6 > In the genome of Aspergillus nidulans ...
Biomedicines | Free Full-Text | Validation of Cell-Free RNA and...
www.mdpi.com
... and Circulating Tumor Cells for Molecular Marker Analysis in Metastatic Prostate Cancer. by. Michael Ladurner. 1 ,. Manuel Wieser. 2,. Andrea Eigentler.
The anisin1 gene encodes a defensin-like protein and supports the...
www.proquest.com
Andrea Eigentler Istvn Pcsi Florentine Marx. Received: 18 August Revised: 17 October Accepted: 24 October Published online: 24 November The Author(s) This article is published with open access at Springerlink.com. Abstract In the genome of Aspergillus nidulans, a defensin-like protein, ...
Oroboros Previous Scientific Collaborators - Bioblast
www.mitoeagle.org
· Andrea Eigentler, Mag. Biol., PhD; PostDoc ( ) (K-Regio MitoCom Tyrol). Dominik Pesta, Mag., PhD; PhD-thesis ( ).
PIAS1 is a crucial factor for prostate cancer cell survival and a valid ...www.oncotarget.com › article › text
www.oncotarget.com
· The authors thank Irma Sottsas, Karin Unterberger and Andrea Eigentler for TMA preparation, paraffin embedding, and immunohistochemical ...
Verwandte Suchanfragen zu Andrea Eigentler
Georg Schäfer Helmut Klocker Florian Handle | Ulrike Binder Andreas Pircher Martin Puhr | Mario Fasching |
Personen Vorname "Andrea" (81002) Name "Eigentler" (15) |
sortiert nach Relevanz / Datum